Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU067571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Creb1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGGTGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCCAACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCTGGAGTTGTTA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000025958

NCBI-Hinterlegungsnummer

NM_001037726

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... CREB1(12912) , Creb1(12912)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mutsumi Fujii et al.
Experimental neurology, 261, 396-403 (2014-07-25)
Early brain injury (EBI) which comprises of vasogenic edema and apoptotic cell death is an important component of subarachnoid hemorrhage (SAH) pathophysiology. This study evaluated whether cannabinoid receptor type 2 (CB2R) agonist, JWH133, attenuates EBI after SAH and whether CB2R
Jian Ye et al.
EMBO molecular medicine, 6(10), 1294-1311 (2014-09-19)
Accumulating evidence suggests the immunosuppressive microenvironments created by malignant tumors represent a major obstacle for effective anti-tumor immunity. A better understanding of the suppressive mechanisms mediated by tumor microenvironments and the development of strategies to reverse the immune suppression are
Wencheng Li et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(2), R138-R147 (2015-05-23)
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet
Kaiyan Hui et al.
Cancer letters, 354(1), 189-199 (2014-08-17)
Supranutritional selenite has anti-cancer therapeutic effects in vivo; however, the detailed mechanisms underlying these effects are not clearly understood. Further studies would broaden our understanding of the anti-cancer effects of this compound and provide a theoretical basis for its clinical
Xiuying Ma et al.
Oncology reports, 35(1), 189-196 (2015-11-05)
In the periphery of pancreatic ductal adenocarcinoma (PDAC), high accumulation of tumor-associated macrophages (TAMs), which exhibit M2 phenotype, has been shown to be correlated with extra-pancreatic invasion, lymph vessel invasion, lymph node involvement and shortened survival time. However, mechanisms by
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.