Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU060821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egr1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000038418

NCBI-Hinterlegungsnummer

NM_007913

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... EGR1(13653) , Egr1(13653)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Prontip Saelee et al.
Frontiers in immunology, 8, 383-383 (2017-04-26)
The transcription factor Ets1 is highly expressed in B lymphocytes. Loss of Ets1 leads to premature B cell differentiation into antibody-secreting cells (ASCs), secretion of autoantibodies, and development of autoimmune disease. Despite the importance of Ets1 in B cell biology
Kazuhide Hayakawa et al.
Stem cell research, 12(2), 531-538 (2014-02-01)
Endothelial progenitor cells (EPCs) may contribute to neurovascular repair after stroke and neurodegeneration. A key step in this process should involve adhesive interactions between EPCs and the targeted cerebral endothelium. Here, we tested the hypothesis that reactive astrocytes may play
Sai Vikram Vemula et al.
Antiviral research, 139, 161-170 (2016-11-28)
The HIV latent CD4 Human CD4 Treatment of primary human CD4 Overall, our results offer new insights into the mechanism of action of PKC agonists, biomarkers of pathway engagement, and the potential role of EGR family in HIV reactivation.
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.