Direkt zum Inhalt
Merck

EMU015681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cyba

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGACGTTTCACACAGTGGTATTTCGGCGCCTACTCTATCGCTGCAGGTGTGCTCATCTGTCTGCTGGAGTATCCCCGGGGAAAGAGGAAAAAGGGGTCCACCATGGAGCGATGTGGACAGAAGTACCTGACCCCTGTGGTGAAGCTTTTCGGGCCCCTCACCAGGAATTACTACGTCCGGGCTGCCCTCCACTTCCTGTTGTCGGTGCCTGCAGGCTTCCTCCTGGCCACCATCCTGGGGACCGTCTGCTTGGCCATTGCCAGTGTGATCTATCTGCTGGCAGCCATCCGAGGTGAGCAGTGGACTCCCATTGAGCCTAAACCCAAGGAGCGGCCACAGGTTGGAGGCACCATCAAGCAACCACCTACCAACCCCCCACCCCGGCCACCCGCAGAGGTCCGAAAGAAGCCGAGTGAGGGTGAAGAGGAG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rui Yamaguchi et al.
Blood cells, molecules & diseases, 57, 85-90 (2016-02-09)
Granulocyte-macrophage colony stimulating factor (GM-CSF) induces procoagulant activity of macrophages. Tissue factor (TF) is a membrane-bound glycoprotein and substance P (SP) is a pro-inflammatory neuropeptide involved in the formation of membrane blebs. This study investigated the role of SP in
Young-Hoon Lee et al.
FEBS letters, 588(17), 3251-3258 (2014-07-30)
The expression of phospholipase D1 (PLD1) and PLD2 were found to decrease at the transcription level during both replicative and premature senescence in human lung fibroblast IMR-90 cells. Knockdown of PLD2 dramatically induced senescent phenotype in proliferating IMR-90 cells and
Jessica M Overstreet et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(4), 1258-1268 (2014-12-07)
Effective therapy to prevent organ fibrosis, which is associated with more than half of all mortalities, remains elusive. Involvement of tumor suppressor ataxia telangiectasia mutated (ATM) in the TGF-β1 pathway related to renal fibrosis is largely unknown. ATM activation (pATM(Ser1981))
Chih-Chang Hung et al.
Oncotarget, 6(6), 4110-4125 (2015-02-18)
Cisplatin (CDDP) is a potent chemotherapeutic agent but resistance to the drug remains a major challenge in cancer treatment. To evaluate the efficacy of CDDP in oral squamous cell carcinoma (OSCC), we found that p22phox was highly expressed in CDDP-resistant

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.