Direkt zum Inhalt
Merck

EHU225481

Sigma-Aldrich

MISSION® esiRNA

targeting human IGHM

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGCCTCGCACAGGACTTCCTTCCCGACTCCATCACTTTCTCCTGGAAATACAAGAACAACTCTGACATCAGCAGCACCCGGGGCTTCCCATCAGTCCTGAGAGGGGGCAAGTACGCAGCCACCTCACAGGTGCTGCTGCCTTCCAAGGACGTCATGCAGGGCACAGACGAACACGTGGTGTGCAAAGTCCAGCACCCCAACGGCAACAAAGAAAAGAACGTGCCTCTTCCAGTGATTGCCGAGCTGCCTCCCAAAGTGAGCGTCTTCGTCCCACCCCGCGACGGCTTCTTCGGCAACCCCCGCAAGTCCAAGCTCATCTGCCAGGCCACGGGTTTCAGTCCCCGGCAGATTCAGGTGTCCTGGCTGCGCGAGGGGAAGCAGGTGGGGTCTGGCGTCACCACGGACCAGGTGCAGGCTGAGGCCAAAGAGTCTGGGCCCACGACCTACAAGGTGACCAGCACACTGACCATCAAAGAGAGCGACTGGCTCAGCCAGAGCATGTTCACCTGC

Ensembl | Human Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IGHM(3507)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ai Kawamoto-Hirano et al.
The Annals of otology, rhinology, and laryngology, 125(3), 219-227 (2015-09-24)
To clarify composite fibers and cells in the synovial tissues of the cricoarytenoid joint (CA joint). Routine histology and immunohistrochemistry using sagittal or nearly sagittal sections obtained from 18 elderly cadaveric specimens. The CA joint capsule was thin and contained
J Westra et al.
Clinical and experimental immunology, 178(1), 40-47 (2014-06-04)
Rituximab (RTX) treatment in rheumatoid arthritis (RA) patients severely hampers humoral response after influenza vaccination as determined by haemagglutination inhibition assay (HI). It is not known whether HI reflects both immunoglobulin (Ig)M and IgG (subclass) influenza response, and whether IgM
Elvira Bailón et al.
Journal of leukocyte biology, 96(2), 185-199 (2014-08-01)
This study addresses the role of (pro)MMP-9 overexpression in CLL cell migration. We have used primary CLL cells and CLL-derived MEC-1 cells transfected with empty (mock cells) or proMMP-9-encoding (MMP-9 cells) lentiviral vectors. The constitutive (pro)MMP-9 expression in mock cells
Willem J J Falkenburg et al.
Arthritis & rheumatology (Hoboken, N.J.), 67(12), 3124-3134 (2015-08-08)
To investigate the presence and patterns of specific IgG subclass recognition by IgM rheumatoid factor (IgM-RF) and IgA-RF with a newly developed enzyme-linked immunosorbent assay (ELISA), which can discriminate between polyspecific and restricted RF responses. Polyspecific and restricted RF responses
Elisabeth M Meulenbroek et al.
Haematologica, 100(11), 1407-1414 (2015-09-12)
In autoimmune hemolytic anemia autoantibodies against erythrocytes lead to increased clearance of the erythrocytes, which in turn results in a potentially fatal hemolytic anemia. Depending on whether IgG or IgM antibodies are involved, response to therapy is different. Proper identification

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.