Direkt zum Inhalt
Merck

EHU157081

Sigma-Aldrich

MISSION® esiRNA

targeting human NFATC2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACCACCACCAGCTATGAGAAGATAGTGGGCAACACCAAAGTCCTGGAGATACCCTTGGAGCCCAAAAACAACATGAGGGCAACCATCGACTGTGCGGGGATCTTGAAGCTTAGAAACGCCGACATTGAGCTGCGGAAAGGCGAGACGGACATTGGAAGAAAGAACACGCGGGTGAGACTGGTTTTCCGAGTTCACATCCCAGAGTCCAGTGGCAGAATCGTCTCTTTACAGACTGCATCTAACCCCATCGAGTGCTCCCAGCGATCTGCTCACGAGCTGCCCATGGTTGAAAGACAAGACACAGACAGCTGCCTGGTCTATGGCGGCCAGCAAATGATCCTCACGGGGCAGAACTTTACATCCGAGTCCAAAGTTGTGTTTACTGAGAAGACCACAGATGGACAGCAAATTTGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Joyce V Lee et al.
Genes & development, 32(7-8), 497-511 (2018-04-21)
The metabolite acetyl-coenzyme A (acetyl-CoA) is the required acetyl donor for lysine acetylation and thereby links metabolism, signaling, and epigenetics. Nutrient availability alters acetyl-CoA levels in cancer cells, correlating with changes in global histone acetylation and gene expression. However, the
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using
Yanjiao Huang et al.
Experimental and therapeutic medicine, 20(2), 736-747 (2020-08-04)
Store-operated Ca2+ entry (SOCE) is the stable calcium channel influx in most cells. It consists of the cytoplasmic ion channel ORAI and endoplasmic reticulum receptor stromal interaction molecule 1 (STIM1). Abolition of SOCE function due to ORAI1 and STIM1 gene
Christina Springstead Scanlon et al.
Nature communications, 6, 6885-6885 (2015-04-29)
Perineural invasion (PNI) is an indicator of poor survival in multiple cancers. Unfortunately, there is no targeted treatment for PNI since the molecular mechanisms are largely unknown. PNI is an active process, suggesting that cancer cells communicate with nerves. However

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.