Direkt zum Inhalt
Merck

EHU151901

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Jin Xu et al.
Oncology letters, 14(2), 2483-2490 (2017-08-07)
Numerous studies have demonstrated that microRNAs (miRs) are involved in several physiological and pathological processes, and participate in cancer initiation and progression. The abnormal expression of miR-150 has been reported in numerous types of human cancer. However, at present there
Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Xiao-Jing Chen et al.
Cell death & disease, 10(7), 508-508 (2019-07-03)
The accumulation of tumour-associated macrophages (TAMs) in the hypoxic tumour microenvironment (TME) is associated with malignant progression in cancer. However, the mechanisms by which the hypoxic TME facilitates TAM infiltration are not fully understood. This study showed that high ZEB1
Hong-Yan Zhang et al.
Gene, 633, 61-65 (2017-08-28)
The myocardial infarction associated transcript (MIAT), a long non-coding RNA (lncRNA), was originally identified as a candidate gene for myocardial infarction, and was recently shown to participate in the progression of cancer and the process of metastasis. However, the biological

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.