Direkt zum Inhalt
Merck

EHU144011

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shu-Ting Pan et al.
BMC cancer, 20(1), 634-634 (2020-07-10)
Drug resistance is a major cause of therapeutic failure that is often associated with elevated autophagy and apurinic/apyrimidinic endonuclease 1 (APE1) expression. Herein, we investigated the role of APE1 and autophagy in A549 cells treated with cisplatin. SILAC proteomics was
Aaron M Fleming et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(10), 2604-2609 (2017-02-02)
Reactive oxygen species (ROS) have emerged as important cellular-signaling agents for cellular survival. Herein, we demonstrate that ROS-mediated oxidation of DNA to yield 8-oxo-7,8-dihydroguanine (OG) in gene promoters is a signaling agent for gene activation. Enhanced gene expression occurs when
Mengxia Li et al.
Nucleic acids research, 46(11), 5664-5677 (2018-05-12)
Base excision repair (BER) handles many forms of endogenous DNA damage, and apurinic/apyrimidinic endonuclease 1 (APE1) is central to this process. Deletion of both alleles of APE1 (a.k.a. Apex1) in mice leads to embryonic lethality, and deficiency in cells can
Hong-Beum Kim et al.
Annals of surgical treatment and research, 92(1), 15-22 (2017-01-17)
Biliary cancer is a highly malignant neoplasm with poor prognosis and most patients need to undergo palliative chemotherapy, however major clinical problem associated with the use of chemotherapy is chemoresistance. So far, we aimed at investigating clinical implications of apurinic/apyrimidinic
Nasrin Akhter et al.
The Journal of biological chemistry, 291(45), 23672-23680 (2016-09-18)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape1/Ref-1) is a multifunctional protein possessing DNA repair, redox control, and transcriptional regulatory activities. Although Ape1/Ref-1 plays multiple roles in the immune system, its functions in helper T (Th) cell activation and differentiation are largely unknown.

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.