Direkt zum Inhalt
Merck

EHU140621

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTCAGTTGGGCCTTCATAAACACTCACCTGGCTGGCTTTGCCTTCCAGGAGGAAGCTGGCTGAAGCAAGGGTGTGGAATTTTAAATGTGTGCACAGTCTGGAAAACTGTCAGAATCAGTTTTCCCATAAAAGGGTGGGCTAGCATTGCAGCTGCATTTGGGACCATTCAAATCTGTCACTCTCTTGTGTATATTCCTGTGCTATTAAATATATCAGGGCAGTGCATGTAAATCATCCTGATATATTTAATATATTTATTATATTGTCCCCCGAGGTGGGGACAGTGAGTGAGTTCTCTTAGTCCCCCCAGAGCTGGTTGTTAAAGAGCCTGGCACCTACCCGCTCTCACTTCATCTGTGTCATCTCTGCACACTCCAGCCCACTTTCTGCCTTCAGCCAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kang Sun et al.
World journal of gastroenterology, 22(42), 9368-9377 (2016-11-30)
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in
Jihyun Yang et al.
Journal of cellular physiology, 234(12), 23033-23042 (2019-05-28)
Bone-resorbing osteoclasts are differentiated from macrophages (MΦ) by M-CSF and RANKL. MΦ can be mainly classified into M1 and M2 MΦ, which are proinflammatory and anti-inflammatory, respectively, but little is known about their osteoclastogenic potential. Here, we investigated the osteoclastogenic
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 202(3), 920-930 (2018-12-30)
Common IFN regulatory factor 5 (IRF5) variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern recognition receptor (PRR)-induced cytokines in macrophages. PRR-initiated pathways also contribute to bacterial clearance, and dysregulation of bacterial clearance can
Hongbin Cai et al.
Biochemical and biophysical research communications, 492(2), 192-198 (2017-08-19)
Ischemia-reperfusion injury (IRI) has been implicated in many pathological conditions, including cardiovascular diseases. Adhesion of leukocytes to the surface of endothelial cells has been considered as one of the principle steps in the pathological cascade of inflammatory tissue damage during
Jie Yan et al.
Journal of immunology (Baltimore, Md. : 1950), 205(4), 1024-1038 (2020-07-22)
Common IRF5 genetic risk variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern-recognition receptor (PRR)-induced cytokines in myeloid cells. However, how myeloid cell-intrinsic IRF5 regulates the multiple distinct checkpoints mediating T cell outcomes in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.