Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Ensembl | Human Hinterlegungsnummer

ENSG00000169710

NCBI-Hinterlegungsnummer

NM_004104

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... FASN(2194) , FASN(2194)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xing Zhong et al.
Oncology letters, 21(4), 245-245 (2021-03-06)
Diffuse large B-cell lymphoma (DLBCL) is the most common and heterogeneous lymphoid malignancy. The subtype with MYC and BCL-2 double-expressor lymphoma (DEL) was defined by its aggressive nature and poor survival outcome. Therefore, the development of effective therapies for the
Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Débora C Bastos et al.
The Journal of pathology, 253(3), 292-303 (2020-11-10)
Loss of the tumor suppressor gene Pten in murine prostate recapitulates human carcinogenesis and causes stromal proliferation surrounding murine prostate intraepithelial neoplasia (mPIN), which is reactive to microinvasion. In turn, invasion has been shown to be regulated in part by
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast
Dan Cao et al.
Liver international : official journal of the International Association for the Study of the Liver, 37(1), 80-89 (2016-06-07)
Although it is well established that fatty acids (FA) are indispensable for the proliferation and survival of cancer cells in hepatocellular carcinoma (HCC), inhibition of Fatty Acid Synthase (FASN) cannot completely repress HCC cell growth in culture. Thus, we hypothesized
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.