Direkt zum Inhalt
Merck

EHU129521

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL12

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAAGCACAACAGCCAAAAAGGACTTTCCGCTAGACCCACTCGAGGAAAACTAAAACCTTGTGAGAGATGAAAGGGCAAAGACGTGGGGGAGGGGGCCTTAACCATGAGGACCAGGTGTGTGTGTGGGGTGGGCACATTGATCTGGGATCGGGCCTGAGGTTTGCCAGCATTTAGACCCTGCATTTATAGCATACGGTATGATATTGCAGCTTATATTCATCCATGCCCTGTACCTGTGCACGTTGGAACTTTTATTACTGGGGTTTTTCTAAGAAAGAAATTGTATTATCAACAGCATTTTCAAGCAGTTAGTTCCTTCATGATCATCACAATCATCATCATTCTCATTCTCATTTTTTAAATCAACGAGTACTTCAAGATCTGAATTTGGCTTGTTTGGAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kangling Xie et al.
American journal of physiology. Cell physiology, 319(3), C579-C588 (2020-07-02)
Identification of specific biomarkers for ischemic stroke is necessary due to their abilities to improve treatment outcomes. Many studies have demonstrated the involvement of microRNAs (miRNAs) in the pathogenesis and complications of ischemic stroke and patient outcomes. We found that
Timo Rademakers et al.
Scientific reports, 7, 45263-45263 (2017-03-30)
During plaque progression, inflammatory cells progressively accumulate in the adventitia, paralleled by an increased presence of leaky vasa vasorum. We here show that next to vasa vasorum, also the adventitial lymphatic capillary bed is expanding during plaque development in humans
Guan-Xi Liu et al.
Brain, behavior, and immunity, 84, 72-79 (2019-11-22)
Conditioned place preference (CPP) is a learned behavior, in which animals learn to associate environmental contexts with rewarding effects. The formation of CPP is an integrated outcome of multiple learning processes. Although multiple anatomical substrates underlying this contextual learning have
Xiaoming Zhu et al.
Experimental cell research, 375(2), 41-50 (2019-01-07)
Cancer-associated fibroblasts (CAFs) play critical roles in tumor progression. However, the role and mechanism underlying CAFs in esophageal cancer (EC) remain unclear. In this study, primary CAFs and normal esophageal fibroblasts (NOFs) were isolated and characterized by immunofluorescence, qRT-PCR and
S J Han et al.
Cell death & disease, 6, e1863-e1863 (2015-08-28)
High-mobility group box 1 (HMGB1) functions as a transcription-enhancing nuclear protein as well as a crucial cytokine that regulates inflammation. This study demonstrated that secretion of HMGB1 due to ultraviolet (UV) radiation inducing ocular surface inflammation-mediated reactive oxygen species (ROS)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.