Direkt zum Inhalt
Merck

EHU125061

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCATGTGGTTTGGTTCCTCTCTGGTGGCTCTTTGGGCTGGTATTGGTGGCTTTCCTTGTGGCAGAGGATGTCTCAAACTTCAGATGGGAGGAAAGAGAGCAGGACTCACAGGTTGGAAGAGAATCACCTGGGAAAATACCAGAAAATGAGGGCCGCTTTGAGTCCCCCAGAGATGTCATCAGAGCTCCTCTGTCCTGCTTCTGAATGTGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yin-Hung Chu et al.
Cells, 9(3) (2020-03-19)
Epithelial-mesenchymal transition (EMT) is strongly correlated with tumor metastasis and contains several protein markers, such as E-cadherin. Carbonic anhydrase III (CA III) exhibits low carbon dioxide hydratase activity in cancer. However, the detailed mechanisms of CA III and their roles
Yanjun Guo et al.
Peptides, 121, 170121-170121 (2019-08-07)
Endothelial dysfunction is considered to be an initial indicator in diabetes-induced macrovascular complications. Evidence has shown that CGRP is an important neuropeptide active in vascular system, especially in vasorelaxation. This study aimed to investigate the role of CGRP in high-glucose-induced
Annachiara Sarnella et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Cell plasticity is the ability that cells have to modify their phenotype, adapting to the environment. Cancer progression is under the strict control of the the tumor microenvironment that strongly determines its success by regulating the behavioral changes of tumor
Ines Block et al.
Oncogene, 38(23), 4560-4573 (2019-02-14)
Breast cancer is a heterogeneous genetic disease driven by the accumulation of individual mutations per tumor. Whole-genome sequencing approaches have identified numerous genes with recurrent mutations in primary tumors. Although mutations in well characterized tumor suppressors and oncogenes are overrepresented
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.