Direkt zum Inhalt
Merck

EHU114041

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGGAGAAGTGGCTAAGGAGTGGCAGGAGCTGGATGACGCAGAGAAGGTCCAGCGGGAGCCTCTGCTCACTCTGGTGAAGGAAATCGTCCCCTATAACATGGCCCACAATGCAGAGCATGAGGCTTGCGACCTGCTTATGGAAATTGAGCAGGTGGACATGCTGGAGAAGGACATTGATGAAAATGCATATGCAAAGGTCTGCCTTTATCTCACCAGTTGTGTGAATTACGTGCCTGAGCCTGAGAACTCAGCCCTACTGCGTTGTGCCCTGGGTGTGTTCCGAAAGTTTAGCCGCTTCCCTGAAGCTCTGAGATTGGCATTGATGCTCAATGACATGGAGTTGGTAGAAGACATCTTCACCTCCTGCAAGGATGTGGTAGTACAGAAACAGATGGCATTCATGCTAGGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Peter Tsvetkov et al.
Nature chemical biology, 15(7), 681-689 (2019-05-28)
The mechanisms by which cells adapt to proteotoxic stress are largely unknown, but are key to understanding how tumor cells, particularly in vivo, are largely resistant to proteasome inhibitors. Analysis of cancer cell lines, mouse xenografts and patient-derived tumor samples
Evert Njomen et al.
Cell chemical biology, 26(9), 1283-1294 (2019-07-23)
The proteolytic arm of the protein homeostasis network is maintained by both the ubiquitin-proteasome system (UPS) and autophagy. A well-balanced crosstalk between the two catabolic pathways ensures energy-efficient maintenance of cellular function. Our current understanding of the crosstalk between the
Christoph Gerhardt et al.
The Journal of cell biology, 210(1), 115-133 (2015-07-08)
Mutations in RPGRIP1L result in severe human diseases called ciliopathies. To unravel the molecular function of RPGRIP1L, we analyzed Rpgrip1l(-/-) mouse embryos, which display a ciliopathy phenotype and die, at the latest, around birth. In these embryos, cilia-mediated signaling was
Peter Tsvetkov et al.
eLife, 4 (2015-09-04)
Proteasomes are central regulators of protein homeostasis in eukaryotes. Proteasome function is vulnerable to environmental insults, cellular protein imbalance and targeted pharmaceuticals. Yet, mechanisms that cells deploy to counteract inhibition of this central regulator are little understood. To find such

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.