Direkt zum Inhalt
Merck

EHU113911

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jiali Ma et al.
Biochemical and biophysical research communications, 484(4), 746-752 (2017-02-06)
The current study focused on the role of Ku70, a DNA-dependent protein kinase (DNA-PK) complex protein, in pancreatic cancer cell resistance to gemcitabine. In both established cell lines (Mia-PaCa-2 and PANC-1) and primary human pancreatic cancer cells, shRNA/siRNA-mediated knockdown of
Ke Luo et al.
OncoTargets and therapy, 11, 7559-7567 (2018-11-23)
As one of the most prevalent malignancies, glioma is characterized by poor prognosis and high mortality rate. Glioma patients may show completely distinct clinical outcomes due to their different molecular patterns. Sirtuin 3 (Sirt3) participates in aging, stress resistance, and
Manila Hada et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13903-13914 (2016-08-05)
The first known function of Ku70 is as a DNA repair factor in the nucleus. Using neuronal neuroblastoma cells as a model, we have established that cytosolic Ku70 binds to the pro-apoptotic protein Bax in the cytosol and blocks Bax's
Raghavendra A Shamanna et al.
Nature communications, 7, 13785-13785 (2016-12-07)
Werner syndrome (WS) is an accelerated ageing disorder with genomic instability caused by WRN protein deficiency. Many features seen in WS can be explained by the diverse functions of WRN in DNA metabolism. However, the origin of the large genomic
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.