Direkt zum Inhalt
Merck

EHU113611

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCTGCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGATTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGAAGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTGCCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAATCCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ning Liu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(7), 603-610 (2017-04-13)
Fibroblast-like synoviocytes (FLS) play an essential role in the pathogenesis of chronic inflammatory diseases, such as rheumatoid arthritis. Paeonol (Pae) is a phenolic compound found in many traditional Chinese medicine remedies. However, the effects of Pae on TNF-α-stimulated FLS and
Yanqiu Wang et al.
Biochemical and biophysical research communications, 524(3), 756-763 (2020-02-10)
Intervertebral disc degeneration (IDD) is typically accompanied by a reduced nutrient supply, which is thought to be a contributor to the apoptosis of nucleus pulposus cells (NPCs). Here, we explored whether Forkhead box O3 (FOXO3), a key transcription factor involved
M Kumazoe et al.
Oncogene, 36(19), 2643-2654 (2016-11-29)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal types of cancer and the 5-year survival rate is only 5%. Several studies have suggested that cancer stem cells (CSCs) are thought to be involved in recurrence and metastasis and
Huaping Zhang et al.
Toxicology letters, 277, 115-122 (2017-07-10)
The antioxidant activity of genistein is associated with preventing atherosclerosis; however, the underlying mechanisms are not fully understood. In this study, human umbilical vein endothelial cells (HUVECs) were pretreated with genistein at different concentrations (10nM, 100nM and 1000nM) for 6h
Rania Bouzeyen et al.
Frontiers in immunology, 10, 2922-2922 (2020-01-11)
Alveolar Macrophages play a key role in the development of a robust adaptive immune response against the agent of Tuberculosis (TB), Mycobacterium tuberculosis (M.tb). However, macrophage response is often hampered by the production of IL-10, a potent suppressor of the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.