Direkt zum Inhalt
Merck

EHU113211

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTGGCTAAGAAGGCGATTACTGCAATCTTTGACCAGTTACTGGAGTTTGTTACTGAAGGATCACATTTTGTTGAAGCAACATATAAGAATCCGGAACTTGATCGAATAGCCACTGAAGATGATCTGGTAGAAATGCAAGGATATAAAGACAAGCTTTCCATCATTGGTGAGGTGCTATCTCGGAGACACATGAAGGTGGCATTTTTTGGCAGGACAAGCAGTGGGAAGAGCTCTGTTATCAATGCAATGTTGTGGGATAAAGTTCTCCCTAGTGGGATTGGCCATATAACCAATTGCTTCCTAAGTGTTGAAGGAACTGATGGAGATAAAGCCTATCTTATGACAGAAGGATCAGATGAAAAAAAGAGTGTGAAGACAGTTAATCAACTGGCCCATGCCCTTCACATGGACAAAGATTTGAAAGCTGGCTGTCTTGTACGTGTGTTTTGGCCAAAAGCAAAATGTGCCCTCTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
Chih-Wei Chen et al.
International journal of molecular sciences, 21(14) (2020-07-28)
NME3 is a member of the nucleoside diphosphate kinase (NDPK) family that binds to the mitochondrial outer membrane to stimulate mitochondrial fusion. In this study, we showed that NME3 knockdown delayed DNA repair without reducing the cellular levels of nucleotide
Irene Bertolini et al.
Developmental cell, 55(2), 163-177 (2020-08-12)
The crosstalk between tumor cells and the adjacent normal epithelium contributes to cancer progression, but its regulators have remained elusive. Here, we show that breast cancer cells maintained in hypoxia release small extracellular vesicles (sEVs) that activate mitochondrial dynamics, stimulate

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.