Direkt zum Inhalt
Merck

EHU108151

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT5A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTGTGGAACCTGAAACCATTCACCACGCGGGATTTCTCCATCAGGTCCCTGGCTGACCGGCTGGGGGACCTGAGCTATCTCATCTATGTGTTTCCTGACCGCCCCAAGGATGAGGTCTTCTCCAAGTACTACACTCCTGTGCTGGCTAAAGCTGTTGATGGATATGTGAAACCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAATGCATCTGCAGATGCTGGGGGCAGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGCCCCCAGGCTCCCTATAACATGTACCCACAGAACCCTGACCATGTACTCGATCAGGATGGAGAATTCGACCTGGATGAGACCATGGATGTGGCCAGGCACGTGGAGGAACTCTTACGCCGACCAATGGACAGTCTTGACTCCCGCCTCTCGCCCCCTGCCGGTCTTTTCACCTCTGCCAGAGGCTCCCTCTCATGAATGTTTGAATCCCACGCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhengzheng Xiao et al.
International journal of molecular medicine, 47(1), 113-124 (2020-11-07)
As hyperprolactinemia is observed in patients with bromocriptine‑resistant prolactinoma, prolactin (PRL) has been implicated in the development of bromocriptine resistance. Since PRL primarily mediates cell survival and drug resistance via the Janus kinase‑2 (JAK2)/signal transducer and activator of transcription 5A (STAT5) signaling pathway
Sean M Holloran et al.
Molecular and cellular endocrinology, 511, 110859-110859 (2020-05-15)
Progesterone and prolactin are two key hormones involved in development and remodeling of the mammary gland. As such, both hormones have been linked to breast cancer. Despite the overlap between biological processes ascribed to these two hormones, little is known
Baosheng Wang et al.
In vitro cellular & developmental biology. Animal, 56(3), 243-252 (2020-02-23)
The prolactin/STAT5 and AKT1/mTOR pathways play a key role in milk protein transcription and translation, respectively. However, the correlation between them in bovine mammary epithelial cells remains unclear. Here, mRNA and protein expression levels of AKT1, STAT5, and mTOR and
Dharmalingam Subramaniam et al.
Cell death & disease, 11(2), 149-149 (2020-02-26)
Osteosarcoma (OS) is the most common primary bone tumor that primarily affects children and adolescents. Studies suggested that dysregulation JAK/STAT signaling promotes the development of OS. Cells treated with pimozide, a STAT5 inhibitor suppressed proliferation and colony formation and induced

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.