EHU099351
MISSION® esiRNA
targeting human CDK1
Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Größe auswählen
20 μG
€ 197,00
50 μG
€ 349,00
€ 197,00
Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)
Alle Fotos(1)
Größe auswählen
Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00
About This Item
UNSPSC-Code:
41105324
NACRES:
NA.51
€ 197,00
Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)
Beschreibung
Powered by Eupheria Biotech
Qualitätsniveau
Produktlinie
MISSION®
Form
lyophilized powder
esiRNA cDNA-Zielsequenz
CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG
Ensembl | Human Hinterlegungsnummer
NCBI-Hinterlegungsnummer
Versandbedingung
ambient
Lagertemp.
−20°C
Verwandte Kategorien
Allgemeine Beschreibung
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Rechtliche Hinweise
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Lagerklassenschlüssel
10 - Combustible liquids
Flammpunkt (°F)
Not applicable
Flammpunkt (°C)
Not applicable
Hier finden Sie alle aktuellen Versionen:
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Jiajia Li et al.
Biochemical and biophysical research communications, 523(2), 434-440 (2019-12-27)
Ovarian cancer is the most lethal gynecological malignancy, but the mechanisms of ovarian cancer progression and cisplatin resistance remain unclear. Emerging evidence suggested that ubiquitin-conjugating enzyme E2C (UBE2C) was highly expressed in a variety of tumors and acted as an
Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
To senesce or not to senesce: how primary human fibroblasts decide their cell fate after DNA damage.
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Chen Sai et al.
International heart journal, 60(2), 374-383 (2019-02-13)
Atrial fibrillation has caused severe burden for people worldwide. Differentiation of fibroblasts into myofibroblasts, and consequent progress in atrial structural remodeling have been considered the basis for persistent atrial fibrillation, yet little is known about the molecular mechanisms underlying the
Active Filters
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung.
