Direkt zum Inhalt
Merck

EHU097271

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM7

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.