Direkt zum Inhalt
Merck

EHU095701

Sigma-Aldrich

MISSION® esiRNA

targeting human NF2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGTTTGGCTGTTATGCAAAGCAGGTGATTTGTCTTAATCAGATAAAAGATAGAGGCTATGGGGGCCTCAAGATTTTTGGAGAGCAGAGGTGGTCTCTGGCAATTCCATCTGGTTTTGAGAAACTTAGCAGCTCACAGAGCACAGAGATCCTGCCTTCTTCCTACTATCAGGCTGACCTAATGGGGTTGGGCTGCTCGGCAACTGCTTGGGTCACCTTGCCCCAAGGAAACCAGCCCTGGGTGCCACCCAGCCACTTAGGGTCTACAGGGTGGGACTCCAGACCTAGAGCGTAAGTATGGATGTTGTGGCCCTGTGTCTTCCTAGTGTGACCCAGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wen-Bin Ou et al.
British journal of cancer, 115(10), 1253-1263 (2016-10-14)
Improved mesothelioma patient survival will require development of novel and more effective pharmacological interventions. TP53 genomic mutations are uncommon in mesothelioma, and recent data indicate that p53 remains functional, and therefore is a potential therapeutic target in these cancers. In
Ramiro Iglesias-Bartolome et al.
Nature cell biology, 17(6), 793-803 (2015-05-12)
Genomic alterations in GNAS, the gene coding for the Gαs heterotrimeric G protein, are associated with a large number of human diseases. Here, we explored the role of Gαs on stem cell fate decisions by using the mouse epidermis as
Yu Mei et al.
Cell communication and signaling : CCS, 15(1), 34-34 (2017-09-20)
Meningiomas are the most common primary intracranial tumors in adults. While a majority of meningiomas are slow growing neoplasms that may cured by surgical resection, a subset demonstrates more aggressive behavior and insidiously recurs despite surgery and radiation, without effective
Xianle Shi et al.
Development (Cambridge, England), 144(21), 3957-3967 (2017-09-28)
The Hippo pathway modulates the transcriptional activity of Yap to regulate the differentiation of the inner cell mass (ICM) and the trophectoderm (TE) in blastocysts. Yet how Hippo signaling is differentially regulated in ICM and TE cells is poorly understood.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.