Direkt zum Inhalt
Merck

EHU092941

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAATCCCTCATTGACGAAGAGGTAATCTACAGTGAGCTGATGAGTGACTTTGAGATGGATGAGAAGGACTTTGCAGCTGACTCTTGGAGTCTTGCTGTGGACAGCAGCTTCCTGCAGCAGCATAAAAAGGAGGTGATGAAGCAGCAAGATGTCATCTATGAGCTAATCCAGACAGAGCTGCACCATGTGAGGACACTGAAGATCATGACCCGCCTCTTCCGCACGGGGATGCTGGAAGAGCTACACTTGGAGCCAGGAGTGGTCCAGGGCCTGTTCCCCTGCGTGGACGAGCTCAGTGACATCCATACACGCTTCCTCAGCCAGCTATTAGAACGCCGACGCCAGGCCCTGTGCCCTGGCAGCACCCGGAACTTTGTCATCCATCGCTTGGGTGATCTGCTCATCAGCCAGTTCTCAGGTCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Michelle Rengarajan et al.
Molecular biology of the cell, 31(19), 2097-2106 (2020-06-26)
Interactions between host cells and individual pathogenic bacteria determine the clinical severity of disease during systemic infection in humans. Vascular endothelial cells, which line the lumen of blood vessels, represent a critical barrier for a bacterium in the bloodstream. These
Meng Pan et al.
Science advances, 6(31), eaaz1534-eaaz1534 (2020-08-14)
Microtubules display dynamic turnover during cell migration, leading to cell contractility and focal adhesion maturation regulated by Rho guanosine triphosphatase activity. This interplay between microtubules and actomyosin is mediated by guanine nucleotide exchange factor (GEF)-H1 released after microtubule depolymerization or
Juan José Sáez et al.
The Journal of cell biology, 218(7), 2247-2264 (2019-06-15)
B lymphocytes capture antigens from the surface of presenting cells by forming an immune synapse. Local secretion of lysosomes, which are guided to the synaptic membrane by centrosome repositioning, can facilitate the extraction of immobilized antigens. However, the molecular basis
Tony Y-C Tsai et al.
Developmental cell, 49(2), 189-205 (2019-04-25)
Efficient chemotaxis requires rapid coordination between different parts of the cell in response to changing directional cues. Here, we investigate the mechanism of front-rear coordination in chemotactic neutrophils. We find that changes in the protrusion rate at the cell front
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.