Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU083941

Sigma-Aldrich

MISSION® esiRNA

targeting human VEGFA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCA

Ensembl | Human Hinterlegungsnummer

ENSG00000112715

NCBI-Hinterlegungsnummer

NM_001025366

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... VEGFA(7422) , VEGF(7422)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jae Hyeop Lee et al.
Journal of controlled release : official journal of the Controlled Release Society, 263, 29-38 (2017-04-05)
RNA, one of the major biological macromolecules, has been considered as an attractive building material for bottom-up fabrication of nanostructures in the past few decades due to advancements in RNA biology, RNA chemistry and RNA nanotechnology. Most recently, an isothermal
Huan Sun et al.
Journal of cellular physiology, 234(11), 20623-20633 (2019-04-21)
Myocardial ischemia is accompanied with hypoxia injury in myocardial cells. Long noncoding RNAs (lncRNA) CAMK2D-associated transcript 1 (C2dat1) C2dat1) has been linked with several ischemic diseases. However, the investigation regarding its role in myocardial ischemia is relatively rare. The aim
Zhaohui Liu et al.
Molecular immunology, 106, 153-158 (2019-01-07)
MicroRNAs (miRNAs) play important roles in kidney development and maintenance of kidney physiological functions. MiR-377 has been reported to regulate inflammation in cardiac and cerebral ischemia. However, it remains unclear whether it has a similar function in renal ischemia/reperfusion (I/R).
So Yoon Ahn et al.
Experimental & molecular medicine, 50(4), 26-26 (2018-04-14)
We previously reported the role of vascular endothelial growth factor (VEGF) secreted by mesenchymal stem cells (MSCs) in protecting against neonatal hyperoxic lung injuries. Recently, the paracrine protective effect of MSCs was reported to be primarily mediated by extracellular vesicle
Yong-Chao Jiang et al.
Journal of biomedical materials research. Part A, 106(6), 1595-1603 (2018-02-11)
During the process of tissue regeneration facilitated by stem cells, physical properties of a scaffold affect behavior and activities of the cell. To enhance differentiation of human mesenchymal stem cells (MSCs) into endothelial-like cells (ELCs), we used electrospun fibrous substrates
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.