Direkt zum Inhalt
Merck

EHU080501

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGAP4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dabin Lee et al.
Cell death & disease, 9(5), 495-495 (2018-05-03)
Chemokine CCL4 (MIP-1β) is released from osteoblast cells to restore the homeostasis of hematopoietic stem cells during the activation of bone marrow. In this study, we investigated the function of CCL4 and its receptor CCR5 during osteoclastogenesis. CCL4 promoted the
P-S Hu et al.
Oncogene, 36(33), 4706-4718 (2017-04-11)
Polycomb group (PcG) proteins play an important role in development and stem cell maintenance, and their dysregulation have been closely linked to oncogenesis and cancer stem cell phenotypes. Here, we found that nervous system polycomb 1 (NSPc1) was highly expressed
Y-B Yu et al.
Acta physiologica (Oxford, England), 219(2), 465-477 (2016-05-28)
Erythropoietin (EPO), the key hormone involved in erythropoiesis, beneficially affects endothelial cells (ECs), but the detailed mechanisms are yet to be completely understood. In this study, we investigated the role of transient receptor potential vanilloid type 1 (TRPV1), a ligand-gated
Yehua Shen et al.
OncoTargets and therapy, 12, 5003-5012 (2019-07-16)
The phenomenon that cancer cells avidly exhibit glycolysis with lactate secretion and decrease in mitochondrial activity under aerobic conditions is known historically as the Warburg effect. Rho GTPase-activating protein 4 (ARHGAP4) is an important negative regulator of the Rho signaling
Suresh Govatati et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1256-1274 (2020-03-13)
In view of our previous observations on differential expression of LMCD1 (LIM and cysteine-rich domains 1) in human versus rodents, we asked the question whether LMCD1 plays a species-specific role in the development of vascular lesions. Approach and Results: A

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.