Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU079681

Sigma-Aldrich

MISSION® esiRNA

targeting human S1PR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00

Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).
Alle Fotos(1)

Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00

Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000170989

NCBI-Hinterlegungsnummer

NM_001400

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... S1PR1(1901) , S1PR1(1901)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number
EDT
UBT
ATS

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Suche nach COA

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized
Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Ting Fang et al.
Frontiers in pharmacology, 11, 529962-529962 (2020-10-27)
Coix Seed Oil (CSO) possesses a wide range of pharmacological activities. Kanglaite Injection, a commercial product of CSO, has been used clinically as an anticancer drug in China for decades. However, its molecular mechanisms on triple-negative breast cancer (TNBC) remains
Zhi Zheng et al.
International immunopharmacology, 66, 224-235 (2018-11-27)
Inflammation-induced lymphangiogenesis is a widely accepted concept. However, most of the inflammatory factors and their related mechanisms have not been clarified. It has been reported that sphingosine-1-phosphate (S1P) is not only closely related to the chronic inflammatory process but also
Shilun Zuo et al.
Molecular neurobiology, 54(2), 1213-1228 (2016-01-29)
Blood-brain barrier preservation plays an important role in attenuating vasogenic brain edema after subarachnoid hemorrhage (SAH). This study was designed to investigate the protective effect and mechanism of artesunate, a traditional anti-malaria drug, on blood-brain barrier after SAH. Three hundred
Alle zugehörigen Dokumente anzeigen

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.