Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU075891

Sigma-Aldrich

MISSION® esiRNA

targeting human SOD2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCA

Ensembl | Human Hinterlegungsnummer

ENSG00000112096

NCBI-Hinterlegungsnummer

NM_000636

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SOD2(6648) , SOD2(6648)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Miyoung Lee et al.
Antioxidants (Basel, Switzerland), 9(1) (2020-01-17)
Umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) are accessible, available in abundance, and have been shown to be a promising source that can regenerate cartilage in patients with osteoarthritis or other orthopedic diseases. Recently, a three-dimensional (3D) cell culture system
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
Serena Sagliocchi et al.
Redox biology, 24, 101228-101228 (2019-06-04)
Thyroid hormone (TH) is a key metabolic regulator that acts by coordinating short- and long-term energy needs. Accordingly, significant metabolic changes are observed depending on thyroid status. Although it is established that hyperthyroidism augments basal energy consumption, thus resulting in
Brianna M Young et al.
Molecular therapy. Methods & clinical development, 14, 113-125 (2019-07-25)
Age-related macular degeneration (AMD) has been linked to oxidative damage and para-inflammation, an activation of inflammasome signaling in the retinal pigment epithelium (RPE) and the underlying choriocapillaris. Herein, we tested the efficacy of a gene-delivered caspase-1 inhibitor in controlling the
You Dong Liu et al.
International journal of cancer, 144(12), 3056-3069 (2018-12-12)
Toll-like receptors (TLRs) play critical roles in host defense after recognition of conserved microbial- and host-derived components, and their dysregulation is a common feature of various inflammation-associated cancers, including gastric cancer (GC). Despite the recent recognition that metabolic reprogramming is
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.