Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU070821

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AATGAAGTTGCGGAAATGTTAAGAGATTTAAATCTTGGTGAAATGAAAAGTGGAGTACCAGTGTTGGCAGTATCCTTAGCATTGGAGGGGAAGGCTAGTCATAGAGAGATGACATCTAAGCTTCTTTCTGACCTTTGTGGGACAGTAATGAGCACAACTGATGTGGAAAAATCATTTGATAAATTGTTGAAAGATCTACCTGAATTAGCACTGGATACTCCTAGAGCACCACAGTTGGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATTTTATGTAATACCTATATTGATAGTTACAAAGGAACTGTAGATTGTGTGCAGGCTAGAGCTGCTCTGGATAAGGCTACCGTGCTTCTGAGTATGTCTAAAGGTGGAAAGCGTAAAGATAGTGTGTGGGGCTCTGG

Ensembl | Human Hinterlegungsnummer

ENSG00000150593

NCBI-Hinterlegungsnummer

NM_014456

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PDCD4(27250) , PDCD4(27250)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hongwei Liang et al.
Scientific reports, 6, 23772-23772 (2016-03-30)
Programmed cell death 4 (PDCD4), as a tumor suppressor gene, is frequently reduced in a variety of tumors, including gastric cancer. Previous findings have indicated that PDCD4 participates in tumorigenesis through the regulation of apoptosis, but the molecular basis of
Xiaodong Chen et al.
Anatomical record (Hoboken, N.J. : 2007), 302(8), 1399-1408 (2018-10-20)
Osteosarcoma (OS) is one of the most common malignancies of bone. This study was aimed to explore the anti-metastatic effect of euxanthone on OS. Adhesion assay and Transwell assay were used to examine the effect of euxanthone on adhesion, migration
Xiafei Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 670-682 (2018-07-20)
Several miRNAs have been reported to be involved in the pathogenesis of polycystic ovarian syndrome (PCOS). However, the biological roles of miR-16 and its molecular mechanisms in PCOS development remain to be elucidated. qRT-PCR was performed to detect the expression
Kun Wang et al.
Molecular medicine reports, 16(5), 6757-6763 (2017-09-14)
Contrast medium (CM) is widely used in cardiac catheterization; however, it may induce acute kidney injury or renal failure, although the underlying mechanism remains to be elucidated. MicroRNA‑21 (miR‑21) is involved in renal disease and has been indicated to regulate
Ken Watanabe et al.
PloS one, 15(2), e0226053-e0226053 (2020-02-11)
Hypertension is a major public health problem among the aging population worldwide. It causes cardiac remodeling, including hypertrophy and interstitial fibrosis, which leads to development of hypertensive heart disease (HHD). Although microRNA-21 (miR-21) is associated with fibrogenesis in multiple organs
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.