Direkt zum Inhalt
Merck

EHU069131

Sigma-Aldrich

MISSION® esiRNA

targeting human XBP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yukako Tokutake et al.
International journal of molecular sciences, 21(1) (2020-01-01)
In skeletal muscle, myoblast differentiation results in the formation of multinucleated myofibers. Although recent studies have shown that unfolded protein responses (UPRs) play an important role in intracellular remodeling and contribute to skeletal muscle differentiation, the involvement of IRE1-XBP1 signaling
A-F Song et al.
European review for medical and pharmacological sciences, 24(22), 11675-11682 (2020-12-05)
Rheumatoid arthritis (RA) is an autoimmune, inflammatory disease mainly manifested by joint damage. Its mechanism is not completely clear at present. Previous studies have found that microRNA-34a-5p (miR-34a-5p) is involved in the development of many inflammatory diseases. In this study
Hui-Ting Hsu et al.
Clinica chimica acta; international journal of clinical chemistry, 479, 66-71 (2018-01-07)
Squamous cell carcinoma is the most common cancer of the oral cavity. In spite of advancements in surgical, chemoradiological and targeted therapies, these therapeutic strategies still have had little impact on survival rates. X-box binding protein-1 (XBP-1) is a potent
Akihiro Kishino et al.
Scientific reports, 7(1), 4442-4442 (2017-07-02)
The purpose of this study was to clarify the relationship among X-box-binding protein 1 unspliced, spliced (XBP1u, s), Forkhead box O1 (FoxO1) and autophagy in the auditory cells under endoplasmic reticulum (ER) stress. In addition, the relationship between ER stress
Joshua M Royal et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 13527-13545 (2019-09-29)
Cholera toxin B subunit (CTB) exhibits broad-spectrum biologic activity upon mucosal administration. Here, we found that a recombinant CTB containing an endoplasmic reticulum (ER) retention motif (CTB-KDEL) induces colon epithelial wound healing in colitis via the activation of an unfolded

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.