Direkt zum Inhalt
Merck

EHU053371

Sigma-Aldrich

MISSION® esiRNA

targeting human SYP

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAGTACCCCTTCAGGCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTTAGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCTCTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAACAAAGGGCCCATGCTGGACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCCAAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCTGTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Teng-Fei Li et al.
Scientific reports, 7, 45056-45056 (2017-03-23)
Bulleyaconitine (BAA) has been shown to possess antinociceptive activities by stimulation of dynorphin A release from spinal microglia. This study investigated its underlying signal transduction mechanisms. The data showed that (1) BAA treatment induced phosphorylation of CREB (rather than NF-κB)
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke
Xiaochun Yang et al.
Oncotarget, 6(8), 6203-6217 (2015-03-10)
Liver dysfunction is a common side effect associated with the treatment of dasatinib and its mechanism is poorly understood. Autophagy has been thought to be a potent survival or death factor for liver dysfunction, which may shed the light on
Bruce C McGorum et al.
Molecular & cellular proteomics : MCP, 14(11), 3072-3086 (2015-09-15)
Equine grass sickness (EGS) is an acute, predominantly fatal, multiple system neuropathy of grazing horses with reported incidence rates of ∼2%. An apparently identical disease occurs in multiple species, including but not limited to cats, dogs, and rabbits. Although the

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.