Direkt zum Inhalt
Merck

EHU047831

Sigma-Aldrich

MISSION® esiRNA

targeting human DDR2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCCCTAATTCTTCCTCCAGCGATGTACGCACTGTCAGTTACACCAATCTGAAGTTTATGGCTACCCAAATTGCCTCTGGCATGAAGTACCTTTCCTCTCTTAATTTTGTTCACCGAGATCTGGCCACACGAAACTGTTTAGTGGGTAAGAACTACACAATCAAGATAGCTGACTTTGGAATGAGCAGGAACCTGTACAGTGGTGACTATTACCGGATCCAGGGCCGGGCAGTGCTCCCTATCCGCTGGATGTCTTGGGAGAGTATCTTGCTGGGCAAGTTCACTACAGCAAGTGATGTGTGGGCCTTTGGGGTTACTTTGTGGGAGACTTTCACCTTTTGTCAAGAACAGCCCTATTCCCAGCTGTCAGATGAACAGGTTATTGAGAATACTGGAGAGTTCTTCCGAGACCAAGGGAGGCAGACTTACCTCCCTCAACCAGCCATTTGTCCTGAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Khairul Anam et al.
Stem cell research & therapy, 4(5), 112-112 (2014-01-11)
Knowing the repertoire of cell signaling receptors would provide pivotal insight into the developmental and regenerative capabilities of bone marrow cell (BMC)-derived hematopoietic stem/progenitor cells (HSPCs) and bone marrow mesenchymal stromal cells (BMMSCs). Murine HSPCs were enriched from fluorescence-activated cell
Shijing Jia et al.
American journal of respiratory cell and molecular biology, 59(3), 295-305 (2018-04-14)
Progressive fibrosis is a complication of many chronic diseases, and collectively, organ fibrosis is the leading cause of death in the United States. Fibrosis is characterized by accumulation of activated fibroblasts and excessive deposition of extracellular matrix proteins, especially type
Mereena George Ushakumary et al.
PloS one, 14(12), e0225911-e0225911 (2019-12-06)
Collagen accumulation and remodeling in the vascular wall is a cardinal feature of vascular fibrosis that exacerbates the complications of hypertension, aging, diabetes and atherosclerosis. With no specific therapy available to date, identification of mechanisms underlying vascular fibrogenesis is an
Binhui Xie et al.
Journal of experimental & clinical cancer research : CR, 34, 101-101 (2015-09-13)
Several studies have found that DDR2 is up-regulated in many tumor types and facilitates tumor progression. However, the role of DDR2 in hepatocellular carcinoma (HCC) progression and its downstream signaling pathways remain unclear. DDR2 expression was assessed in several cell

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.