Direkt zum Inhalt
Merck

EHU034121

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Ke Wu et al.
Antioxidants & redox signaling, 30(17), 1983-1998 (2018-05-29)
Aims: Epidemiologic evidence indicates that diabetes may increase risk of breast cancer (BC) and mortality in patients with cancer.
Mi Yeong Kim et al.
Scientific reports, 9(1), 7044-7044 (2019-05-09)
c-Fms is the macrophage colony-stimulating factor (M-CSF) receptor, and intracellular signalling via the M-CSF/c-Fms axis mediates both innate immunity and bone remodelling. M-CSF-induced transient proteolytic degradation of c-Fms modulates various biological functions, and protein kinase C (PKC) signalling is activated
Molly Butts et al.
Nutrients, 11(10) (2019-10-23)
Malnutrition is present in chronic alcoholics. However, how moderate alcohol consumption affects the absorption of nutrients like glutamine has not been investigated. Glutamine, an amino acid, is vital to gastrointestinal health. Glutamine is absorbed via sodium-dependent glutamine co-transport (B0AT1; SLC6A19)
Tianchao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 395-402 (2016-09-27)
Application of general anesthetics may induce neurotoxicity in dorsal root ganglia (DRG) neurons. In this study, we examined the possible protective mechanism and associated signaling pathways of small-molecule glycogen synthase kinase-3 (GSK-3) inhibitor, SB216763, in bupivacaine-injured mouse DRG neurons in

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.