Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU024531

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K14

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTGAGGACAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCA

Ensembl | Human Hinterlegungsnummer

ENSG00000006062

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MAP3K14(9020) , MAP3K14(9020)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kislay Parvatiyar et al.
Nature communications, 9(1), 2770-2770 (2018-07-19)
Detection of viral genomes by the innate immune system elicits an antiviral gene program mediated by type I interferons (IFNs). While viral RNA and DNA species induce IFN via separate pathways, the mechanisms by which these pathways are differentially modulated
Miles C Duncan et al.
PloS one, 12(2), e0171406-e0171406 (2017-02-07)
Infection of human cells with Yersinia pseudotuberculosis expressing a functional type III secretion system (T3SS) leads to activation of host NF-κB. We show that the Yersinia T3SS activates distinct NF-κB pathways dependent upon bacterial subcellular localization. We found that wildtype
Po Y Mak et al.
British journal of haematology, 167(3), 376-384 (2014-08-01)
Overexpression of the apoptosis repressor with caspase recruitment domain (ARC, also termed NOL3) protein predicts adverse outcome in patients with acute myeloid leukaemia (AML) and confers drug resistance to AML cells. The second mitochondrial-derived activator of caspases (SMAC, also termed
Paulina Kucharzewska et al.
Journal of cell science, 132(7) (2019-03-07)
NF-κB-inducing kinase (NIK; also known as MAP3K14) is a central regulator of non-canonical NF-κB signaling in response to stimulation of TNF receptor superfamily members, such as the lymphotoxin-β receptor (LTβR), and is implicated in pathological angiogenesis associated with chronic inflammation
Katharina Mörs et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 17-30 (2017-08-30)
Alcohol (ethanol, EtOH) as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma) was linked to nuclear factor-kappaB (NF-ĸB). Here, we analyzed alcohol`s effects and mechanisms underlying its
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.