Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU113381

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAGAGAACCAGGTGAATGTCACCTGCCAGGTGAGGAAGTTCTACCCCCAGAGACTACAGCTGACCTGGTTGGAGAATGGAAACGTGTCCCGGACAGAAACGGCCTCAACCGTTACAGAGAACAAGGATGGTACCTACAACTGGATGAGCTGGCTCCTGGTGAATGTATCTGCCCACAGGGATGATGTGAAGCTCACCTGCCAGGTGGAGCATGACGGGCAGCCAGCGGTCAGCAAAAGCCATGACCTGAAGGTCTCAGCCCACCCGAAGGAGCAGGGCTCAAATACCGCCGCTGAGAACACTGGATCTAATGAACGGAACATCTATATTGTGGTGGGTGTGGTGTGCACCTTGCTGGTGGCCCTACTGATGGCGGCCCTCTACCTCGTCCGAATCAGACAGAAGAAAGCCCAGG

Ensembl | human accession no.

ENSG00000198053

NCBI accession no.

NM_080792

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SIRPA(140885) , SIRPA(140885)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jieqiong Wang et al.
Breast cancer research and treatment, 148(2), 279-289 (2014-10-11)
Signal transducer and activator of transcription 3 (STAT3) is implicated breast cancer metastasis and represents a potential target for developing new anti-tumor metastasis drugs. The purpose of this study is to investigate whether the natural agent 1'-acetoxychavicol acetate (ACA), derived
Tiantian Sun et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(17), 4689-4704 (2014-07-06)
The role and clinical implication of the transmembrane protein with EGF and two follistatin motifs 2 (TMEFF2) in gastric cancer is poorly understood. Gene expression profile analyses were performed and Gene Set Enrichment Analysis (GSEA) was used to explore its
Ji Hoon Jung et al.
British journal of pharmacology, 172(14), 3565-3578 (2015-04-01)
Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Derivatives of EGCG were
Ross C Gruber et al.
Glia, 63(10), 1753-1771 (2015-04-29)
We have previously described reduced myelination and corresponding myelin basic protein (MBP) expression in the central nervous system of Src homology 2 domain-containing protein tyrosine phosphatase 1 (SHP-1) deficient motheaten (me/me) mice compared with normal littermate controls. Deficiency in myelin
Chulwon Kim et al.
Molecular carcinogenesis, 53(10), 793-806 (2013-06-15)
Constitutive activation of STAT3 is frequently observed and closely linked with proliferation, survival, invasion, metastasis and angiogenesis in tumor cells. In the present study, we investigated whether β-caryophyllene oxide (CPO), a sesquiterpene isolated primarily from the essential oils of medicinal

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico