Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU008611

Sigma-Aldrich

MISSION® esiRNA

targeting human IFIH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCATGGAGGAGGAACTGTTGACAATTGAAGACAGAAACCGGATTGCTGCTGCAGAAAACAATGGAAATGAATCAGGTGTAAGAGAGCTACTAAAAAGGATTGTGCAGAAAGAAAACTGGTTCTCTGCATTTCTGAATGTTCTTCGTCAAACAGGAAACAATGAACTTGTCCAAGAGTTAACAGGCTCTGATTGCTCAGAAAGCAATGCAGAGATTGAGAATTTATCACAAGTTGATGGTCCTCAAGTGGAAGAGCAACTTCTTTCAACCACAGTTCAGCCAAATCTGGAGAAGGAGGTCTGGGGCATGGAGAATAACTCATCAGAATCATCTTTTGCAGATTCTTCTGTAGTTTCAGAATCAGACACAAGTTTGGCAGAAGGAAGTGTCAGCTGCTTAGATGAAAGTCTTGGACATAACAGCAACATGGGCA

Ensembl | human accession no.

ENSG00000115267

NCBI accession no.

NM_022168

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IFIH1(64135) , IFIH1(64135)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seung Bum Park et al.
PloS one, 11(7), e0158419-e0158419 (2016-07-13)
Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I
Ian T Lamborn et al.
The Journal of experimental medicine, 214(7), 1949-1972 (2017-06-14)
MDA5 is a cytosolic sensor of double-stranded RNA (ds)RNA including viral byproducts and intermediates. We studied a child with life-threatening, recurrent respiratory tract infections, caused by viruses including human rhinovirus (HRV), influenza virus, and respiratory syncytial virus (RSV). We identified
Tatsuro Saruga et al.
Molecular biology reports, 48(1), 425-433 (2021-01-03)
C-X-C motif chemokine 10 (CXCL10) is an inflammatory chemokine and a key molecule in the pathogenesis of rheumatoid arthritis (RA). Melanoma differentiation-associated gene 5 (MDA5) is an RNA helicase that plays a role in innate immune and inflammatory reactions. The
Chia-Lin Chen et al.
Nature communications, 8, 13882-13882 (2017-01-10)
B-cell infection by hepatitis C virus (HCV) has been a controversial topic. To examine whether HCV has a genetically determined lymphotropism through a co-receptor specific for the infection by lymphotropic HCV, we established an infectious clone and chimeric virus of
Tongtian Zhuang et al.
Cell death & disease, 11(6), 453-453 (2020-06-14)
Vitiligo is a disfiguring disease featuring chemokines-mediated cutaneous infiltration of autoreactive CD8+ T cells that kill melanocytes. Copious studies have indicated that virus invasion participates in the pathogenesis of vitiligo. IFIH1, encoding MDA5 which is an intracellular virus sensor, has
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico