Unfortunately, no review or reference is available for this product.
Select a Size
$534.00
Select a Size
About This Item
$534.00
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATGGAGCTCTCCTGGTAGCAGTTTGTCGTGGTAAAGTGAGTGAGGGTCTGGATTTCTCAGATGACAATGCCCGTGCTGTCATAACAATAGGAATTCCTTTTCCAAATGTGAAAGATCTACAGGTTGAACTAAAACGACAATACAATGACCACCATTCAAAATTGAGAGGTCTTCTACCTGGCCGTCAGTGGTATGAAATTCAAGCATACAGGGCCTTAAACCAGGCCCTTGGTAGATGTATTAGACACAGAAATGATTGGGGAGCTCTTATTCTAGTGGATGATCGCTTTAGGAATAACCCAAGTCGCTATATATCTGGACTTTCTAAATGGGTACGGCAGCAGATTCAGCACCATTCAACCTTTGAAAGTGCACTGGAATCCTTGGCTGAATTTTCCAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BRIP1(83990) , BRIP1(83990)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Not finding the right product?
Try our Product Selector Tool.
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
-
Can you provide a review/reference of this product? Provide the details of its usage by some other group
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service