Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Ensembl | human accession no.

ENSG00000136826

NCBI accession no.

NM_004235

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KLF4(9314) , KLF4(9314)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Takuya Nagata et al.
Breast cancer (Tokyo, Japan), 24(2), 326-335 (2016-06-15)
Prognosis of breast cancer patients has been reported to depend on the expression of induced pluripotent stem (iPS) cell-inducing factors: KLF4 and NANOG. However, the relationship between KLF4 or NANOG expression in each breast cancer subtype and the life prognosis
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Lianjun Lin et al.
Scientific reports, 7(1), 15847-15847 (2017-11-22)
Epithelial-mesenchymal transition (EMT) plays an important role in the pathogenesis of idiopathic pulmonary fibrosis (IPF). Krüpple-like-factor 4 (KLF4), has been suggested to play an important role in the phenotype transition. However, its function in pulmonary fibrosis and EMT of human
Renzhi Yu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 39(6), 1010428317705574-1010428317705574 (2017-06-21)
Non-small cell lung cancer is one of the most common epithelial tumors that cause the most common cancer-related mortality due to invasive ability. Research has found that Kruppel-like factor 4, a zinc-finger transcription factor, plays a critical role in the
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service