Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

Storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

D-J Huang et al.
European review for medical and pharmacological sciences, 20(24), 5098-5106 (2017-01-05)
We investigated the interactions among the dysregulated genes in hepatocellular carcinoma (HCC) and identified the hub genes in the protein-protein interaction (PPI) network. Also, we also investigated the regulative effect of miR-379 on the IGF1/IGF1R signaling pathway and chemoresistance in
Yiren Hu et al.
Pathology, research and practice, 215(12), 152674-152674 (2019-11-17)
Hepatocellular carcinoma (HCC) is among the most frequently observed forms of cancer. MicroRNAs (miRNAs) are increasingly thought to play a key role in regulating the onset and progression of a wide range of cancer types. In the present report, we
Fangzheng Zhou et al.
Oncology reports, 38(3), 1857-1866 (2017-07-22)
Lung cancer is one of the most common types of malignancy in humans and is a leading cause of cancer-related deaths among men and women worldwide. Aberrantly expressed microRNAs in non-small cell lung cancer (NSCLC) contribute to tumor occurrence and
Riyo Morimoto-Kamata et al.
Cancer science, 108(8), 1574-1583 (2017-05-26)
Cathepsin G (CG), a neutrophil serine protease, induces cell migration and multicellular aggregation of human breast cancer MCF-7 cells in a process that is dependent on E-cadherin and CG enzymatic activity. While these tumor cell aggregates can cause tumor emboli
Yanxin Fan et al.
Molecular medicine reports, 20(1), 81-94 (2019-05-23)
It has been demonstrated that microRNAs (miRNAs) serve important roles in various biological processes, such as tumorigenesis. In the present study, the role of miR‑30a‑3p in the pathogenesis of esophageal carcinoma (EC) was investigated. Reverse transcription‑quantitative polymerase chain reaction was

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service