Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU017231

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC22A5

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGATGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTGGTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGTGATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCCGAGTGAGTTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACCTGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTGGATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGACATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kei Higuchi et al.
Drug metabolism and pharmacokinetics, 30(2), 182-187 (2015-04-11)
Memantine is clinically used for the treatment of patients with Alzheimer's disease and is highly distributed to the brain. The aim of this study is to characterize memantine transport at the blood-brain barrier (BBB) using hCMEC/D3 cells, a human BBB
Mitsuko Akaihata et al.
Molecular and cellular biochemistry, 459(1-2), 49-59 (2019-05-18)
Glucocorticoid (GC) resistance is associated with poor response to the following chemotherapy in lymphoid malignancies, such as lymphoma and leukemia. However, it remains unclear whether GCs interfere with the cytotoxic effects of anti-cancer drugs on GC-resistant cells. In this study
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service