Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU016801

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Satomi Furukawa et al.
Experimental cell research, 383(1), 111506-111506 (2019-07-22)
NOD-like receptor family, pyrin domain-containing 3 (NLRP3) is one of the key components of the inflammasome. NLRP3 also participates in the regulation of fibrosis independent of the inflammasome. In this study, we analyzed the mechanism of upregulation of NLRP3 expression
Danae E Zamboulis et al.
eLife, 9 (2020-10-17)
Mature connective tissues demonstrate highly specialised properties, remarkably adapted to meet their functional requirements. Tissue adaptation to environmental cues can occur throughout life and poor adaptation commonly results in injury. However, the temporal nature and drivers of functional adaptation remain
Hendrik Ungefroren et al.
Cancers, 12(12) (2020-12-03)
Autocrine transforming growth factor (TGF)β has been implicated in epithelial-mesenchymal transition (EMT) and invasion of several cancers including pancreatic ductal adenocarcinoma (PDAC) as well as triple-negative breast cancer (TNBC). However, the precise mechanism and the upstream inducers or downstream effectors

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service