Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU014871

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTTTTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCAAATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGAAAGAGATATGTAGAAGGCACAATATGGGCACTTTAAATGAAGCTAATAATTCTTCACCTAAGTCTCTGTGAATTGAAATGTTCGTTTTCTCCTGCCTGTGCTGTGACTCGAGTCACACTCAAGGGAACTTGAGCGTGAATCTGTATCTTGCCGGTCATTTTTATGTTATTACAGGGCATTCAAATGGGCTGCTGCTTAGCTTGCACCTTGTCACATAGAGTGATCTTTCCCAAGAGAAGGGGAAGCACTCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Marina Boruk et al.
Scientific reports, 10(1), 16350-16350 (2020-10-03)
Chronic rhinosinusitis (CRS) is a common condition associated with inflammation and tissue remodeling of the nose and paranasal sinuses, frequently occurring with nasal polyps and allergies. Here we investigate inflammation and the protease profile in nasal tissues and plasma from
Yu Jin et al.
Journal of Cancer, 10(12), 2720-2734 (2019-07-02)
MicroRNA-519d (miR-519d) has been reported to play important roles in tumor development and progression in multiple cancers, either as tumor suppressor or tumor promotor. However, the expression level, biological function and molecular mechanisms of miR-519d in oral squamous cell carcinoma
Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells
Yu Deng et al.
Scientific reports, 10(1), 1386-1386 (2020-01-30)
High estrogen concentration leads to an inflammatory reaction in the mammary gland tissue in vivo; however, the detailed mechanism underlying its specific effects on the breast duct has not been fully clarified. We used 3D-cultured MCF-10A acini as a breast
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service