Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU073481

Sigma-Aldrich

MISSION® esiRNA

targeting human EZH2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTTGGAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hailong Liu et al.
Molecular cancer research : MCR, 15(9), 1275-1286 (2017-05-26)
Medulloblastoma is the most common malignant brain tumor in children. Although accumulated research has suggested that cancer stem-like cells play a key role in medulloblastoma tumorigenesis, the specific molecular mechanism regarding proliferation remains elusive. Here, we reported more abundant expression
Junchao Xue et al.
Biochimica et biophysica acta, 1863(3), 753-763 (2017-01-08)
Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of
Jiewei Xu et al.
Pathology, research and practice, 215(6), 152374-152374 (2019-04-07)
EZH2 is a core component of the polycomb repressive complex 2 (PRC2), which catalyzes trimethylation of histone H3 lysine 27 (H3K27me3) and promotes carcinogenesis by epigenetically silencing many tumor suppressor genes. Increased EZH2 expression is a marker of advanced and
Jun Ni et al.
Cell death & disease, 10(5), 355-355 (2019-05-03)
3-deazaneplanocin A (3-DZNeP) has been used as an inhibitor of enhancer of zeste homolog 2 (EZH2). Here, we explore the role and underlying mechanisms action of 3-DZNeP in abrogating cisplatin nephrotoxicity. Exposure of cultured mouse renal proximal tubular epithelial cells
Maria Angelica Stamato et al.
Oncotarget, 8(63), 106527-106537 (2018-01-02)
Downregulation of tumor suppressor (TS) microRNAs (miRNAs) commonly occurs in human cancer, including multiple myeloma (MM). We previously demonstrated that miR-29b is a relevant TS miRNA, whose expression in MM cells is inhibited by HDAC4-dependent deacetylation. Here, we provide novel

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service