Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU090571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnmt1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCCCAGATGTTGACCAGTGAGAAACTGTCCATCTACGACTCCACCTCGACCTGGTTTGATACTTATGAAGATTCTCCCATGCATAGGTTCACTTCCTTCAGTGTGTACTGCAGTCGCGGGCACCTGTGTCCTGTCGACACCGGTCTCATTGAGAAGAATGTAGAGCTCTACTTTTCTGGGTGTGCCAAAGCAATTCATGACGAGAATCCATCTATGGAAGGTGGTATTAATGGCAAAAACCTCGGGCCAATCAATCAGTGGTGGCTCAGTGGCTTTGATGGTGGCGAGAAGGTGCTCATTGGCTTCTCCACTGCATTTGCTGAATACATTTTGATGGAGCCCAGCAAAGAGTATGAGCCAATATTTGGGCTGATGCAGGAGAAAATTTACATCAGCAAGATTGTTGTTGAGTTCCTGCAAAACAATCCTGATGCTGTATATGAAGACCTGATCAATAAGATTGAGACCACTGTTCCTCCTTCTACCATTAATGTGAACCGGTTCACAGAGGACTCCCTCTTACGCCACGCCCAGTTTGTAGTGAGCCAGGTAGAGAGTTACGACGAAGCCAAGG

Ensembl | mouse accession no.

ENSMUSG00000004099

NCBI accession no.

NM_010066

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... DNMT1(13433) , Dnmt1(13433)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sichen Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(22), 5808-5822 (2014-09-17)
IDH1/2-mutant gliomas harbor a distinct glioma-CpG island methylation phenotype (G-CIMP) that may promote the initiation and progression of secondary pathway gliomas by silencing tumor-suppressive genes. The potential role of tumor-suppressive microRNAs (miRNA; miR) in this process is not understood. To
Hui Zhang et al.
Theriogenology, 84(6), 846-852 (2015-07-22)
RNA interference is an important tool to study the gene function. Microinjection and electroporation are usually used to transfer DNA, small interference RNA (siRNA), morpholinos, and protein into oocytes or embryos. This study used a simple and effective method to
A K Mitra et al.
Oncogene, 34(48), 5923-5932 (2015-03-24)
The cross-talk between ovarian cancer (OvCa) cells and the metastatic microenvironment is an essential determinant of successful colonization. MicroRNAs (miRNAs) have several critical roles during metastasis; however, the role of microenvironmental cues in the regulation of miRNAs in metastasizing cancer
Kanwalat Chalertpet et al.
Cancer science, 106(10), 1333-1340 (2015-08-08)
Human papillomavirus (HPV) oncoproteins drive distinctive promoter methylation patterns in cancer. However, the underlying mechanism remains to be elucidated. Cyclin A1 (CCNA1) promoter methylation is strongly associated with HPV-associated cancer. CCNA1 methylation is found in HPV-associated cervical cancers, as well

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service