Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU131771

Sigma-Aldrich

MISSION® esiRNA

targeting human HAS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGGGTGTGTTCAGTGCATTAGTGGACCTCTGGGAATGTACAGAAACTCCTTGTTGCATGAGTTTGTGGAAGATTGGTACAATCAAGAATTTATGGGCAACCAATGTAGCTTTGGTGATGACAGGCATCTCACGAACCGGGTGCTGAGCCTGGGCTATGCAACAAAATACACAGCTCGATCTAAGTGCCTTACTGAAACACCTATAGAATATCTCAGATGGCTAAACCAGCAGACCCGTTGGAGCAAGTCCTACTTCCGAGAATGGCTGTACAATGCAATGTGGTTTCACAAACATCACTTGTGGATGACCTACGAAGCGATTATCACTGGATTCTTTCCTTTCTTTCTCATTGCCACAGTAATCCAGCTCTTCTACCGGGGTAAAATTTGGAACATTCTCCTCTTCTTGTTAACTGTCCAGCTAGTAGGTCTCATAAAATCATCTTTTGCCAGCTGCCTTA

Ensembl | human accession no.

ENSG00000170961

NCBI accession no.

NM_005328

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HAS2(3037) , HAS2(3037)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hong Zhan et al.
Fertility and sterility, 114(4), 888-898 (2020-08-09)
To investigate the role(s) of hyaluronan synthase 2 (HAS2) and hyaluronan in disease progression of endometriosis and epidermal growth factor (EGF)-induced motility changes of endometriotic cells. A case-control experimental study and in vitro primary cell culture study. University hospital-affiliated research centers.
Xiaoyan Chen et al.
Cell communication and signaling : CCS, 18(1), 89-89 (2020-06-11)
Hyaluronan (HA) is an abundant component of the bone marrow (BM) extracellular matrix. Here, we investigated the abnormal deposition of HA in the BM microenvironment and its remodelling in mediating the malignancy of breast cancer cells (BCCs). BCCs were transplanted
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
Priscilla Soulié et al.
American journal of physiology. Cell physiology, 307(8), C745-C759 (2014-08-29)
Generation of branched tubes from an epithelial bud is a fundamental process in development. We hypothesized that induction of hyaluronan synthase (Has) and production of hyaluronan (HA) drives tubulogenesis in response to morphogenetic cytokines. Treatment of J3B1A mammary cells with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico