Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU090991

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATA

Ensembl | nº de acceso humano

ENSG00000007372

Nº de acceso NCBI

NM_001604

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PAX6(5080) , PAX6(5080)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
MYU
AUU
WQS
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110381-110381 (2020-09-06)
Colorectal cancer is a kind of gastrointestinal tumor with rising morbidity and mortality. 5-fluorouracil is one of the most effective chemotherapy drugs for the treatment of CRC. However, clinical data reported dramatic resistance on the treatment for CRC with 5-fluorouracil.
Hassan Akrami et al.
Journal of ophthalmic & vision research, 4(3), 134-141 (2009-07-01)
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in
Zhe Qian et al.
Respiratory research, 19(1), 262-262 (2018-12-31)
This study investigated the function of SMAD3 (SMAD family member 3) in regulating PAX6 (paired box 6) in non-small cell lung cancer. First, qRT-PCR was employed to detect SMAD3 expression in cancer tissues along with normal tissues and four cell lines
Akira Ooki et al.
Oncogene, 37(45), 5967-5981 (2018-07-08)
It remains unclear whether PAX6 acts as a crucial transcription factor for lung cancer stem cell (CSC) traits. We demonstrate that PAX6 acts as an oncogene responsible for induction of cancer stemness properties in lung adenocarcinoma (LUAD). Mechanistically, PAX6 promotes
Zhengjia Liu et al.
American journal of translational research, 12(6), 2538-2553 (2020-07-14)
This article explored LINC01619 impact on non-small cell lung cancer (NSCLS) development. LINC01619 expression in tumor tissues/normal tissues of NSCLS patients was detected by qRT-PCR and in situ hybridization. PAX6 expression in clinical tissues was researched by immunohistochemistry. After transfection
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico