Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU062731

Sigma-Aldrich

MISSION® esiRNA

targeting human PHF8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCGCCATCATTCACTGTGAGGGATGTTGAACACTATGTTGGTTCTGACAAAGAGATTGATGTGATTGATGTGACCCGCCAGGCTGACTGCAAGATGAAGCTTGGTGATTTTGTGAAATACTATTACAGCGGGAAGAGGGAGAAAGTCCTCAATGTCATTAGTTTGGAATTCTCTGATACCAGACTTTCTAACCTTGTGGAGACACCGAAGATTGTTCGAAAGCTGTCATGGGTCGAAAACTTGTGGCCAGAGGAATGTGTCTTTGAGAGACCCAATGTACAGAAGTACTGCCTCATGAGTGTGCGAGATAGCTATACAGACTTTCACATTGACTTTGGTGGCACCTCTGTCTGGTACCATGTACTCAAGGGTGAAAAGATCTTCTACCTGATCCGCCCAACAAATGCCAATCTGACTCTCTTTGAGTGCTGGAGCAGTTCCTCTAATCAGAATGAGATGTTCTTTGGGGACCA

Ensembl | human accession no.

ENSG00000172943

NCBI accession no.

NM_015107

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PHF8(23133) , PHF8(23133)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming-Zhi Cai et al.
Technology in cancer research & treatment, 19, 1533033820967472-1533033820967472 (2020-10-29)
Plant homeodomain finger protein 8 (PHF8) has been reported to participate in cancer development and metastasis of various types of tumors. However, little is known about the functional mechanism of PHF8 in gastric cancer (GC). This study aimed to explore
D Tong et al.
Oncogenesis, 5(12), e283-e283 (2016-12-20)
Recent studies provide strong evidence that the androgen receptor (AR) signaling pathway remains active in castration-resistant prostate cancer (CRPC). However, the underlying mechanisms are not well understood. In this study, we demonstrate that plant homeo domain finger protein 8 (PHF8
Peterson Kariuki Maina et al.
Oncotarget, 7(46), 75585-75602 (2016-10-01)
Epigenetic factors play critical roles in prostate cancer (PCa) development. However, how they contribute to neuroendocrine differentiation (NED) and castration-resistant PCa (CRPC) is not fully understood. Using bioinformatics and biochemical approaches to analyze cell-based models of NED and CRPC, we
Matthias S Leisegang et al.
FEBS letters, 593(5), 487-498 (2019-02-14)
Histone3-lysine9 (H3K9) residues not only control gene expression, but also contribute to RNA splicing. Here, the H3K9 histone demethylase PHF8 was investigated in endothelial cells for its involvement in alternative splicing. An angiogenic sprouting assay shows the importance of PHF8
Peterson Kariuki Maina et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1860(9), 1002-1012 (2017-07-25)
Hypoxia through transcription factor HIF1α plays a critical role in cancer development. In prostate cancer, HIF1α interplays with androgen receptor (AR) to contribute to the progression of this disease to its lethal form-castration-resistant prostate cancer (CRPC). Hypoxia upregulates several epigenetic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico