Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU071991

Sigma-Aldrich

MISSION® esiRNA

targeting human VCP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG

Ensembl | nº de acceso humano

ENSG00000165280

Nº de acceso NCBI

NM_007126

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... VCP(7415) , VCP(7415)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QDV
CAV
RUU
SSU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sevil Cayli et al.
Theriogenology, 158, 196-206 (2020-09-24)
p97/valosin-containing protein (VCP) is expressed in many cells and plays critical functions in a broad range of diverse cellular processes. Because it is expressed in the mouse testes, predominantly in Sertoli cells, and is known to play a critical role
Wallaya Phongphaew et al.
Virus research, 228, 114-123 (2016-12-05)
Valosin-containing protein (VCP) is classified as a member of the type II AAA
Katrin Schweitzer et al.
Journal of cellular and molecular medicine, 20(1), 58-70 (2015-10-16)
Cullin-RING-ubiquitin-ligase (CRL)-dependent ubiquitination of the nuclear factor kappa B (NF-κB) inhibitor IκBα and its subsequent degradation by the proteasome usually precede NF-κB/RelA nuclear activity. Through removal of the CRL-activating modification of their cullin subunit with the ubiquitin (Ub)-like modifier NEDD8
Richard Wargachuk et al.
Cellular signalling, 30, 50-58 (2016-11-27)
GPCRs form signalling complexes with other receptors as part of dimers, G proteins and effector partners. A proteomic screen to identify proteins that associate with the β
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico