Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU028351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurka

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTGGCAAACGCTCTGTCTTACTGTCATTCAAAGAGAGTGATCCACAGAGACATTAAGCCAGAGAACTTACTGCTTGGCTCAAACGGAGAGTTGAAGATTGCAGACTTCGGGTGGTCGGTGCATGCTCCATCTTCCAGGAGAACCACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAAGGCCGGATGCATGACGAGAAGGTGGACCTCTGGAGCCTGGGCGTTCTCTGCTATGAGTTCCTAGTGGGGATGCCTCCTTTCGAGGCACATACGTACCAGGAGACTTACAGAAGGATATCTCGGGTTGAATTCACTTTCCCTGACTTTGTGACAGAGGGAGCCAGGGACCTCATTTCAAGACTGTTAAAACACAACGCAAGCCAAAGGCTAACACTAGCGGAAGTCCTTGAGCACCCTTGGATCAAAGCTAATTCTTCCAAACCTCCAACTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Saishu Yoshida et al.
eLife, 9 (2020-08-08)
Mammalian Hedgehog (Hh) signaling plays key roles in embryogenesis and uniquely requires primary cilia. Functional analyses of several ciliogenesis-related genes led to the discovery of the developmental diseases known as ciliopathies. Hence, identification of mammalian factors that regulate ciliogenesis can
Jingjing Li et al.
Oncotarget, 6(11), 9327-9340 (2015-04-15)
Mitosis is choreographed by a number of protein kinases including polo-like kinases and Aurora kinases. As these kinases are frequently dysregulated in cancers, small-molecule inhibitors have been developed for targeted anticancer therapies. Given that PLK1 and Aurora kinases possess both
Hua Yang et al.
Oncotarget, 5(10), 2947-2961 (2014-06-17)
Aurora A and JAK2 kinases are involved in cell division and tumor cell survival, respectively. Here we demonstrate that ectopic expression of Aurora A and JAK2 together is more effective than each alone at inducing non-transformed cells to grow in
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service