Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU219141

Sigma-Aldrich

MISSION® esiRNA

targeting human UGT1A3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$377.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$377.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCATTGGGGGCATCAACTGTGCCAACAGGAAGCCACTATCTCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

Storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xueyan Zhou et al.
Nature communications, 5, 4573-4573 (2014-09-04)
Bile acids play a pivotal role in the pathological development of inflammatory bowel disease (IBD). However, the mechanism of bile acid dysregulation in IBD remains unanswered. Here we show that intestinal peroxisome proliferator-activated receptor α (PPARα)-UDP-glucuronosyltransferases (UGTs) signalling is an
Jinkyoung Kim et al.
BMC cancer, 13, 383-383 (2013-08-14)
Heregulin (HRG; also known as neuregulin) is a ligand for ErbB3. One of its isotypes, HRG-β1, binds to ErbB3 and forms heterodimers with other ErbB family members, thereby enhancing the proliferation and tumorigenesis of breast cancer cells. HRG stimulation may
Nicolás Sarute et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(32), 19497-19506 (2020-07-29)
Understanding the genetics of susceptibility to infectious agents is of great importance to our ability to combat disease. Here, we show that voltage-gated calcium channels (VGCCs) are critical for cellular binding and entry of the New World arenaviruses Junín and
Tingting Lin et al.
Journal of experimental & clinical cancer research : CR, 38(1), 150-150 (2019-04-10)
Deregulated ErbB signaling plays an important role in tumorigenesis of pancreatic cancer. However, patients with pancreatic cancer benefit little from current existed therapies targeting the ErbB signaling. Here, we explore the potential anti-tumor activity of Valproic acid against pancreatic cancer
Ming-Chieh Shun et al.
Journal of oncology, 2010, 824571-824571 (2010-03-13)
RRR-alpha-tocopherol derivative alpha-TEA (RRR-alpha-tocopherol ether-linked acetic acid analog) has been shown to be a potent antitumor agent both in vivo and in vitro. In this study, we investigated the effects of alpha-TEA on the expression of epidermal growth factor receptor

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service