Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU150831

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGGTCCTTGAGGTGAGTGACCACCAAGTGCTAAATGACGCCGAGGTTGCCGCCCTCCTGGAGAACTTCAGCTCTTCCTATGACTATGGAGAAAACGAGAGTGACTCGTGCTGTACCTCCCCGCCCTGCCCACAGGACTTCAGCCTGAACTTCGACCGGGCCTTCCTGCCAGCCCTCTACAGCCTCCTCTTTCTGCTGGGGCTGCTGGGCAACGGCGCGGTGGCAGCCGTGCTGCTGAGCCGGCGGACAGCCCTGAGCAGCACCGACACCTTCCTGCTCCACCTAGCTGTAGCAGACACGCTGCTGGTGCTGACACTGCCGCTCTGGGCAGTGGACGCTGCCGTCCAGTGGGTCTTTGGCTCTGGCCTCTGCAAAGTGGCAGGTGCCCTCTTCAACATCAACTTCTACGCAGGAGCCCTCCTGCTGGCCTGCATCAGCTTTGACCGCTACCTGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cecelia C Yates-Binder et al.
PloS one, 7(7), e40812-e40812 (2012-07-21)
Angiogenesis plays a critical role in processes such as organ development, wound healing, and tumor growth. It requires well-orchestrated integration of soluble and matrix factors and timely recognition of such signals to regulate this process. Previous work has shown that
Jinghua Du et al.
Theranostics, 7(17), 4192-4203 (2017-11-22)
Mitochondrial dysfunction plays a crucial role in the development of non-alcoholic steatohepatitis (NASH). However, the regulator of mitochondrial dysfunction in the pathogenesis of NASH is still largely unclear. CXCR3 is an essential pro-inflammatory factor in chronic liver diseases. We explored
Oisun Jung et al.
Journal of cell science, 132(20) (2019-09-29)
When targeted by the tumor-promoting enzyme heparanase, cleaved and shed syndecan-1 (Sdc1) then couples VEGFR2 (also known as KDR) to VLA-4, activating VEGFR2 and the directed migration of myeloma cells. But how VEGFR2 activates VLA-4-mediated motility has remained unknown. We now

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service