Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU148811

Sigma-Aldrich

MISSION® esiRNA

targeting human SMN1, SMN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hirotake Ichise et al.
PloS one, 11(3), e0150521-e0150521 (2016-03-08)
Phospholipase Cγ2 (PLCγ2)-deficient mice exhibit misconnections of blood and lymphatic vessels, and male infertility. However, the cell type responsible for vascular partitioning and the mechanism for male infertility remain unknown. Accordingly, we generated a mouse line that conditionally expresses endogenous
Thomas Koed Doktor et al.
Nucleic acids research, 45(1), 395-416 (2016-08-26)
Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes.
Adriana Roithová et al.
Nucleic acids research, 48(11), 6184-6197 (2020-05-07)
Spliceosomal small nuclear ribonucleoprotein particles (snRNPs) undergo a complex maturation pathway containing multiple steps in the nucleus and in the cytoplasm. snRNP biogenesis is strictly proofread and several quality control checkpoints are placed along the pathway. Here, we analyzed the
Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service