Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU138481

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX11

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATGTTCGACCTGAGCTTGAATTTCTCTCAAAGCGCGCACAGCGCCAGCGAGCAGCAGCTGGGGGGCGGCGCGGCGGCCGGGAACCTGTCCCTGTCGCTGGTGGATAAGGATTTGGATTCGTTCAGCGAGGGCAGCCTGGGCTCCCACTTCGAGTTCCCCGACTACTGCACGCCGGAGCTGAGCGAGATGATCGCGGGGGACTGGCTGGAGGCGAACTTCTCCGACCTGGTGTTCACATATTGAAAGGCGCCCGCTGCTCGCTCTTTCTCTCGGAGGGTGCAGAGCTGGGTTCCTTGGGAGGAAGTTGTAGTGGTGATGATGATGATGATAATGATGATGATGATGGTGGTGTTGATGGTGGCGGTGGTAGGGTGGAGGGGAGAGAAGAAGATGCTGATGATATTGATAAGATGTCGTGACGCAAAGAAA

Ensembl | human accession no.

ENSG00000176887

NCBI accession no.

NM_003108

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SOX11(6664) , SOX11(6664)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lei Chang et al.
American journal of cancer research, 7(11), 2305-2317 (2017-12-09)
To explore the functions of
Feng Xue et al.
Oncology letters, 21(4), 255-255 (2021-03-06)
The dysregulation of lncRNA TMPO antisense RNA 1 (TMPO-AS1) has been detected in various malignant tumors. However, the role of lncRNA TMPO-AS1 remains unclear in pancreatic carcinoma. The present study aimed to elucidate the functional mechanism of TMPO-AS1 in pancreatic
Mingxing Fang et al.
International journal of molecular medicine, 47(1), 361-373 (2020-11-26)
The aim of the present study was to explore the potential role of SOX11 in the stretch‑induced mechanical injury to alveolar type 2 epithelial (AT2) cells. A cell stretch (CS) test was used to induce mechanical injury to primary cultured AT2 cells. Wound
Atish Mohanty et al.
Blood, 133(4), 306-318 (2018-12-12)
The neural transcription factor SOX11 is usually highly expressed in typical mantle cell lymphoma (MCL), but it is absent in the more indolent form of MCL. Despite being an important diagnostic marker for this hard-to-treat malignancy, the mechanisms of aberrant
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service