Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU111271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPA1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTGGAGGTGGTGGAAGCTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cheng-Kai Chang et al.
PloS one, 12(11), e0188214-e0188214 (2017-11-18)
The viral ribonucleoprotein (vRNP) of influenza A virus is formed by virion RNA (vRNA), viral polymerase complex, and nucleoprotein (NP). The NP plays an important role in facilitating the replication and stabilization of viral RNA. To explore host factors that
Mariana D Mandler et al.
Nucleic acids research, 42(11), 7319-7329 (2014-05-06)
The selective RNA-binding protein quaking I (QKI) plays important roles in controlling alternative splicing (AS). Three QKI isoforms are broadly expressed, which display distinct nuclear-cytoplasmic distribution. However, molecular mechanisms by which QKI isoforms control AS, especially in distinct cell types
Mei-Ling Li et al.
Methods (San Diego, Calif.), 183, 13-20 (2020-02-23)
Enterovirus A71 (EV-A711) RNA contains an internal ribosomal entry site (IRES) to direct cap-independent translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs). We previously showed that hnRNP A1, the mRNA stability factor HuR, and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service